The SloR/Dlg Metalloregulator Modulates Streptococcus mutans Virulence Gene Expression

PubMed Central (PMC)

Abstract

Metal ion availability in the human oral cavity plays a putative role in Streptococcus mutans virulence gene expression and in appropriate formation of the plaque biofilm. In this report, we present evidence that supports such a role for the DtxR-like SloR metalloregulator (called Dlg in our previous publications) in this oral pathogen. Specifically, the results of gel mobility shift assays revealed the sloABC, sloR, comDE, ropA, sod, and spaP promoters as targets of SloR binding. We confirmed differential expression of these genes in a GMS584 SloR-deficient mutant versus the UA159 wild-type progenitor by real-time semiquantitative reverse transcriptase PCR experiments. The results of additional expression studies support a role for SloR in S. mutans control of glucosyltransferases, glucan binding proteins, and genes relevant to antibiotic resistance. Phenotypic analysis of GMS584 revealed that it forms aberrant biofilms on an abiotic surface, is compromised for genetic competence, and demonstrates heightened incorporation of iron and manganese as well as resistance to oxidative stress compared to the wild type. Taken together, these findings support a role for SloR in S. mutans adherence, biofilm formation, genetic competence, metal ion homeostasis, oxidative stress tolerance, and antibiotic gene regulation, all of which contribute to S. mutans-induced disease.

———
Streptococcus mutans, the principal causative agent of dental caries, is a successful oral pathogen owing to its ability to adhere to host tissues, form biofilms, and adapt to conditions of oxidative stress and low pH. Adherence of S. mutans to the tooth surface facilitates the colonization of other oral pathogens and hence the formation of a mixed-species biofilm known as dental plaque. In the plaque environment, S. mutans generates lactic acid as a by-product of sugar metabolism, resulting in a localized drop in pH at the tooth surface and the demineralization of tooth enamel. In addition to direct damage to the dentition, S. mutans can also cause endocarditis, a life-threatening valvular inflammation of the heart (

8

). The present study centers on the investigation of a putative role for the SloR metalloregulator in Streptococcus mutans virulence gene expression.

Metal ions such as iron and manganese are essential micronutrients, and their incorporation has been implicated in the pathogenesis of many bacteria, including Legionella pneumophila, Mycobacterium tuberculosis, Staphylococcus epidermidis, and Streptococcus gordonii (

2

,

9

,

16

,

24

,

30

,

33

,

34

,

35

). Specifically, iron is an important enzyme cofactor in the respiratory pathways of many aerobic and anaerobic microorganisms (

26

). However, the accumulation of iron in bacteria can lead to the production of toxic oxygen radicals via Fenton chemistry. Thus, while sufficient levels of iron are necessary to promote bacterial survival and growth, its intracellular transport must be tightly controlled.

Iron availability is also restricted in the mammalian host, where it is sequestered to host proteins such as transferrin and lactoferrin (

42

,

46

). Such an iron-withholding system protects the host from the harmful effects of reactive oxygen species while restricting the availability of this essential micronutrient to invading pathogens. In response, microorganisms have evolved specialized mechanisms for robbing iron from host proteins, some of which depend on small iron chelating molecules called siderophores. In previous work, we and others confirmed a siderophore-independent mechanism for iron transport in S. mutans (

12

,

38

).

Manganese is another essential micronutrient of particular importance to the oral streptococci (

39

). In fact, high concentrations of manganese have been strongly correlated with increased prevalence of dental caries (

1

,

5

). This is not surprising given that sucrose-dependent adherence and glucan binding by the mutans group streptococci both require manganese (

4

,

25

). Unlike iron, however, manganese does not promote Fenton chemistry but rather plays a crucial role in bacterial defense against oxidative stress (

2

,

49

). This is so, in part, because manganese serves as a cofactor for superoxide dismutase, which facilitates the conversion of damaging oxygen radicals into harmless by-products.

Metalloregulatory proteins have been implicated in virulence gene control for a variety of gram-positive pathogens, including Mycobacterium tuberculosis (IdeR), Staphylococcus epidermidis (SirR), and Corynebacterium diphtheriae (DtxR) (

3

,

16

,

27

). These bacterial metalloregulators repress the transcription of downstream genes upon binding to palindromic consensus sequences when free iron or manganese is available. However, in the human host, where metal ions are limiting, these consensus sequences remain unoccupied, and the transcription of genes, some of which may contribute to virulence, is derepressed. A report in the literature describes inactivation of the IdeR metalloregulator in M. tuberculosis which attenuates virulence in vivo (

27

), and others describe targets of the DtxR transcriptional regulator in Corynebacterium diphtheriae, which include the disease-causing diphtheria toxin (tox) gene (

21

,

37

,

40

).

Numerous SloR homologs have also been identified for streptococci, including the recently reported MtsR metalloregulator in Streptococcus pyogenes, which has been implicated in iron homeostasis and oxidative stress tolerance (

3

). Other SloR homologs that likely contribute to virulence include the ScaR and AdcR metalloregulators in S. gordonii, which modulate transcription of the scaCBA and adcCBA operons, respectively. Both of these operons encode manganese transport systems that are required for genetic competence and biofilm formation (

17

,

24

).

Previously, we described the cariogenic potential of an S. mutans UA130 sloR-deficient mutant (GMS800), as attenuated in a germ-free rat model, thereby implicating SloR as a metalloregulator in S. mutans-induced disease (

38

). In addition, work conducted in our laboratory and by others revealed that the expression of sloC, an LraI lipoprotein adhesin and metal ion transporter, contributes to S. mutans-induced disease and is subject to repression by SloR when free iron or manganese is plentiful. In contrast, sloC expression is derepressed when the availability of these metal ions becomes limiting (

18

,

38

). Taken together, these findings implicate metal ions in the regulation of S. mutans virulence gene expression.

In the present study, we hypothesize a role for the S. mutans SloR metalloregulator similar to that of its DtxR homolog in C. diphtheriae and propose that either iron or manganese can associate with the metalloregulator to modulate virulence gene expression. This suggests the presence of a SloR regulon in this oral pathogen that promotes the expression of virulence genes in a host organism where metal ions are limiting. Herein, we describe the characterization of the S. mutans UA159 sloR-deficient mutant (GMS584) and identify multiple virulence attributes that are targeted by the SloR metalloregulator. SloR modulation of S. mutans virulence gene expression in response to metal ion availability is likely a significant contributor to caries formation, and its study could reveal novel candidates for therapeutic intervention.

MATERIALS AND METHODS

Bacterial strains, plasmids, and primers.

Bacterial strains and plasmids used in the present study are described in Table

1

. Oligonucleotide primers designed using MacVector 7.0 software and purchased from Sigma Genosys (St. Louis, Mo.) are presented in Table

2

.

TABLE 1.

Bacterial strains and plasmids used in this study

Strain or plasmidGenotype or phenotypeSource or referenceStrainsStreptococcus mutans UA159Wild type, serotype cATCC 700610 GMS584UA159 derived, sloR deficient, EmrThis work GMS585GMS584 transformed with plasmid pER4This workcitM deficientUA159 derived, EmrUniversity of TorontoEscherichia coli DH5αF−supE44 ΔlacU169 φ80dlacZΔM15 hsdR17 recA1 endA1 gyrA96 thi-1 relA

15

TB1F−araΔ(lac-proAB) φ80dlacZΔM15 rps (Strr) thi hsdRNew England BioLabsPlasmids pDL277E. coli-streptococcal shuttle vector, Spr

6

pER4pDL277 derived, harbors sloR gene, SprThis work pMal-c2xE. coli expression vector with MBP, AprNew England BioLabs pMal-c2x:SloRE. coli pMal-c2x containing SloR, AprThis workTABLE 2.

List of primers used in this study

Primer usePrimer nameNucleotide sequence (5′ to 3′)Annealing temp (°C)

c

Amplicon size (bp)

c

PCR ligation mutagenesis

a

dlg.LR.P1GGCGCGCCGAAAGGTTTCCGCCTACTCCCAGC52.3441dlg.LR.P2GGCGCGCCGCGATGCTTGCGATAAAGAGATGACGdlg.LR.P3GGCCGGCCCCGCATGGAGGGACCATTCC53.4513dlg.LR.P4GGCCGGCCAGCTGAAACCATTTCGGAAGTCGAGerm.Asc1.FGGCGCGCCCCGGGCCCAAAATTTGTTTGAT52.3860erm.Fse1.RATTCTATGAGTCGCTGCCGACTGGCCGGCCReal-time PCRdlg.intern.LR.FCATCTCTTTATCGCAAGCATCG49.1127dlg.intern.LR.RCGTTCAACAAACACATCAGAAACAGfimA.GS.RCCAGCCTGTCCTTTTTTAGCAAC52.2186fimA.GS.FCGAAGAAGAGGGAACACCAAATCropA.realtime.FCGGTCGCTAATGCTGAAATCG51.2113ropA.realtime.RCTCTGATGAAATCCCTTGGCGsko6 FGTTTAGGTATGTTGTCAATGAACG47.4137sko6 RCAGTTGTCCAAGAGGAATAGAAGsko9 FGTTCTAATGTCTGATACAATCGGCTTGC50.082sko9 RCAGTTAGAGCCTCACCAGCAACAATGcomD FTTATGGTCTGCTGCCTGTTG51.6161comD RACACACTGAGAAAGAGGTAACTTAGCcomE FCACAACAACTTATTGACGCTATCCC49.8106comE FTGATTGGCTACTTCCAGTCCTTTCspaP FTTTGCCGATGAAACGACCAC50.6106spaP RTACTCGCACTCCCTTGAGCCTCsod FGGCTCAGGTTGGGCTTGGTTAG53.5128sod RGCGTGTTCCCAGACATCAAGTGCgbpB FTGGACAATGGGCAGCAAGTG53.9124gbpB RTTGAACACCTGTAACATAAGCAACGgtfB FTACACTTTCGGGTGGCTTGG50.0135gtfB RGCTTCTTGCTTAGATGTCACTTCGCloning

b

dlg.LR.BamHI.FCGGGATCCCGGGTTTCCGCCTACTCCCAGC53.51,063dlg.LR.BamHI.RCGGGATCCCGGCTGAAACCATTTCGGAAGTCGAGDlg_c ForwardATGACACCTAATAAAGAAGATTACC51.1756Dlg_c ReverseTGCGAAAATTTCAAAAAGCAGel mobility shiftpreSloABCForATCGGTGAATCGCACTGTCG51.1310preSloABCRevTAAGGTTGACTTGCCCGCACpreSloR FAAGGTTTCCGCTTACTCCC49.8306preSloR RACCATTTCTGAGACAGCCGpreRopAForGGATTTCATAAAACCCTCTTC44.9203preRopARevATGTAACAACACCACGATTGcomD FTGAAAATAGCATAGGTGAGTCAAAG48.6268comD RATTTAGGTTAGCTGATTAACACTATACACrecA.Gel.LN.FCGGTTATCCAAAAGGGCGTATC55.3212recA.Gel.LN.RCCTGTTCTCCTGAATCTGGTTGTGpresod-PCR-AS-FCGTGATTCAAGAACACTCA47.3315presod-PCR-AS-RCTGGTAAAAGAATAGCCATAspaP.BK.ForwardGGCCAGAACATCTAGTCCAACTCAG50.7225spaP.BK.ReverseCGAGCACAAACTCCACACTTTATCCa

AscI restriction sites appear in boldface type, whereas FseI restriction sites are underlined.

b

BamHI cut sites are underlined and appear in boldface type.

c

Annealing temperatures and amplicon sizes are relevant to the primer pair.

Bacteriological media and reagents.

Escherichia coli DH5α and TB1 cells were grown at 37°C in L broth with gentle aeration. E. coli transformants were also grown in this manner, with the addition of 100 μg/ml ampicillin or 100 μg/ml spectinomycin to the medium. S. mutans cultures for RNA isolation, biofilm formation, and Western blot analysis were grown at 37°C and 5% CO2 in a semidefined medium (SDM) that contained 0.38 μM Fe and 1.75 μM Mn, as determined by inductively coupled argon plasma analysis. For metal ion incorporation assays, S. mutans was grown in Todd-Hewitt broth (THB) at 37°C and 5% CO2. For all other assays, S. mutans was grown at 37°C and 5% CO2 in THB supplemented with 0.3% yeast extract (THYE). Spectinomycin (1,200 μg/ml) or erythromycin (10 μg/ml) was added to THYE to select for transformants. All buffers and reagents for purification of the SloR and maltose binding proteins (MBP) were prepared according to the pMal protein and purification system instruction manual and in accordance with the recommendations of the supplier (New England BioLabs, Beverly, MA).

Cloning of the S. mutans sloR gene.

A 1,063-bp amplicon that harbors the wild-type sloR coding sequence and promoter region, amplified with primers dlg.LR.BamHI.F and dlg.LR.BamHI.R (Table

2

), was cloned into the BamHI site of the replicative shuttle plasmid pDL277. The resulting recombinant was introduced into E. coli DH5α by electroporation (

36

), and transformants were selected on L agar supplemented with spectinomycin. Plasmid DNA was isolated from selected transformants on minispin columns according to the recommendations of the supplier (QIAGEN) and subsequently mapped with restriction enzymes to confirm the presence of the pER4 recombinant construct.

Construction of S. mutans GMS584, a sloR-deficient mutant.

An established PCR ligation mutagenesis approach (

20

) was used to inactivate the sloR gene on the S. mutans chromosome. Primers dlg.LR.P1, dlg.LR.P2, dlg.LR.P3, and dlg.LR.P4 (Table

2

) were used to amplify the 5′ and 3′ regions of the sloR coding sequence from the S. mutans UA159 chromosome by use of a thermal cycler (Hybaid, Ltd., Ashford, United Kingdom) for 94°C for 10 min, 35 cycles at 94°C for 1 min, optimal annealing temperature (Table

2

) for 2 min, 72°C for 2 min, and 72°C for 10 min. The resulting 5′ and 3′ sloR amplicons were digested with AscI and FseI and ligated to an ermAM amplicon with compatible AscI and FseI overhangs. The ligation mixture was then used as a template for PCR amplification with primers dlg.LR.P1 and dlg.LR.P4. The resulting amplification products, including a 1,784-bp sloR:ermAM:sloR linear construct (Fig.

1a

), were used to transform S. mutans UA159 in the presence of 150 μg competence-stimulating peptide (CSP) (

22

). Transformants were selected on THYE agar plates supplemented with erythromycin. Chromosomal DNA was isolated from selected transformants according to established protocols (

36

), and PCR and nucleotide sequencing with primers dlg.LR.P1 and dlg.LR.P4 were used to confirm sloR disruption by allelic exchange (Fig.

1b and c

). The resulting sloR mutant was named GMS584.

FIG. 1.

FIG. 1.
FIG. 1.

Construction of an S. mutans sloR-deficient mutant (GMS584) by PCR ligation mutagenesis. (a) We generated a 139-bp deletion in the sloR coding sequence, into which an 860-bp ermAM cassette was ligated. The resulting product was introduced into the UA159 genome by allelic exchange. (b) Amplicons derived by PCR confirm disruption of the sloR coding sequence by ermAM. A 1,063-bp wild-type fragment is increased by the size of ermAM, minus the 139-bp deletion, to yield a 1,784-bp product in the mutant. (c) Nucleotide sequence across the sloR-ermAM cassette junction further confirms disruption of the sloR coding sequence.

Complementation of the sloR mutation in S. mutans GMS584.

Plasmid pER4 was used to complement the sloR mutation in S. mutans GMS584 in trans. The plasmid was introduced into S. mutans by CSP-induced transformation as described previously (

22

), and transformants resistant to spectinomycin were selected on THYE agar plates. Complementation of the sloR-specific mutation in the resulting strain, GMS585, was confirmed with real-time PCR experiments by monitoring sloR- and sloC-specific expression.

Isolation and purification of the S. mutans SloR protein.

The sloR gene and flanking DNA sequences were PCR amplified from the S. mutans UA159 chromosome with sloR-specific primers Dlg_c Forward and Dlg_c Reverse (Table

2

) and in the presence of Platinum Taq DNA high-fidelity polymerase (Invitrogen). The cycling conditions consisted of a 94°C denaturation step for 2 min, followed by 35 cycles at 94°C for 30 s, 50°C for 2 min, and 68°C for 1 min, followed by a 10-min extension period at 68°C. The resulting 756-bp amplicon was PCR purified (QIAGEN), digested with the restriction enzyme XbaI, and ligated into the XbaI and XmnI cloning sites on the pMal-c2x vector (New England BioLabs) with T4 DNA ligase (Promega) at 16°C overnight. The ligation mixture was then used to electroporate E. coli DH5α (

36

), and transformants resistant to ampicillin were selected on X-Gal (5-bromo-4-chloro-3-indolyl-β-d-galactopyranoside)- and IPTG (isopropyl-β-d-thiogalactopyranoside)-containing L ampicillin plates. Plasmid DNA was isolated from selected colonies on minispin columns (QIAGEN) and used as a template for PCR amplification with vector-specific primers dlg.intern.LR.F and dlg.intern.LR.F (Table

2

) to confirm the presence of the sloR insert. Recombinant plasmids that harbored the sloR gene were transformed into E. coli TB1 cells for subsequent SloR purification according to the pMal protein fusion and purification system instruction manual (New England BioLabs). The protein purification procedure was repeated with E. coli TB1 transformants containing the cloned MBP gene for use in gel mobility shift assays.

In silico analysis.

The PredictRegulon search engine (

47

) was used to search the S. mutans UA159 genome for sequence homology to a 22-bp SloR consensus sequence (AAATTAACTTGACTTAATTTTT) (

18

), as well as to 24-bp (AAAAATTAACTTGACTTAATTTTT) and 38-bp (CTAATATAAAAATTAACTTGACTTAATTTTTATATTAG) versions of the consensus sequence. The search variables for upstream and downstream positioning of this sequence were set at 300 bp and 20 bp, respectively. Targets identified by PredictRegulon were subsequently screened for characteristic stem-loop secondary structure by use of Mfold algorithms, with conditions for folding set at 37°C, 300 mM sodium, and 0 mM magnesium (

50

).

Gel mobility shift assays.

Gel mobility shift assays were performed using a protocol developed by John Murphy at Boston University (

31

), with some modifications. The promoter region of genes targeted for SloR binding were PCR amplified with specific primer sets (Table

2

) and end labeled in a reaction mixture containing [γ-32P]ATP (Perkin Elmer) and 10 U of T4 polynucleotide kinase (New England BioLabs). Following incubation at 37°C for 30 min and then at 70°C for 20 min, the final sample volume was brought to 100 μl with sterile distilled water. Unincorporated radiolabel was removed by passing the reaction mixture through a G-25 Sepharose column (Roche Applied Science, Indianapolis, IN). Binding reactions were performed in a 16-μl total volume containing 1 μl of end-labeled DNA, 2.5 μg of either the SloR fusion protein or the MBP, and 3.2 μl of 5× binding buffer (42 mM NaH2PO4, 58 mM Na2HPO4, 250 mM NaCl, 25 mM MgCl2, 50 μg/ml bovine serum albumin, 1 mg sonicated salmon sperm DNA, and 99% sterile glycerol). In separate assays, 2.5, 5, 10, or 25 μg of the SloR fusion protein was used in binding reactions to determine whether the SloR fusion protein forms oligomers. In additional gel shift assays, crude cell lysate from S. mutans UA159 and GMS584 was used to confirm a dysfunctional SloR protein in the mutant. The 5× binding buffer was supplemented with MnCl2 to a final concentration of 150 mM for binding reactions. EDTA was added to some of the reaction mixtures at a final concentration of 15 mM to determine whether SloR binding was metal ion dependent. A 212-bp amplicon that harbors the S. mutans recA gene was used as a negative control to confirm SloR binding specificity to its proposed targets. Competition assays, in which up to 10-fold excess cold recA DNA was added to reaction mixtures containing end-labeled target DNA, were also performed. All reaction mixtures were incubated at room temperature for 20 min and then resolved on 18% nondenaturing polyacrylamide gels for 1 h at 300 V. The gels were processed for autoradiography and exposed to Kodak BIOMAX film for 10 h at −80°C in the presence of an intensifying screen.

RNA isolation.

S. mutans UA159 and GMS584 cultures grown to mid-logarithmic phase (optical density at 600 nm [OD600] of ∼0.5) in SDM were harvested by centrifugation and stored in RNAlater according to the manufacturer's instructions (Ambion). The 10-ml RNAlater suspension was diluted in 15 ml 1× phosphate-buffered saline (PBS), harvested at 7,000 rpm for 20 min in a Sorvall RC5B centrifuge, and resuspended in 3ml Trizol reagent (Invitrogen). The suspension was divided equally into two tubes, each containing a zirconium bead lysing matrix, and mechanically disrupted at 4°C in a BIO101 Fast Prep machine run for 40 s on setting 6. Nucleic acids were ethanol precipitated overnight and collected by centrifugation at 12,000 rpm for 20 min in a refrigerated IEC Micromax RF microcentrifuge. The supernatant was aspirated away from visible pellets, and the pellets were resuspended in nuclease-free water. Nucleic acid was further purified and DNase I treated on an RNeasy column (QIAGEN) according to the recommendations of the supplier. RNA integrity was assessed by ethidium bromide staining of the 23S and 16S ribosomal subunits on 1% agarose gels. Total intact RNA was quantified with a Genosys spectrophotometer (Fisher Biotech), and an OD260:OD280 ratio was obtained to estimate purity.

Real-time qRT-PCR.

Real-time semiquantitative reverse transcriptase PCR (qRT-PCR) was used to monitor the transcription of S. mutans genes whose promoter regions bind SloR as determined in silico and/or by gel mobility shift assays. Specifically, a first-strand cDNA synthesis kit (MBI Fermentas, Burlington, Ontario, Canada) was used in accordance with the recommendations of the supplier to reverse transcribe 1 μg of total RNA isolated from S. mutans UA159 and GMS584 as described above. Reverse transcriptase negative controls, corresponding to each of the experimental conditions, were prepared in parallel except that the Moloney murine leukemia virus reverse transcriptase was omitted from the reaction mixture. Next, 10 ng of cDNA (RNA equivalents) was amplified in a Cepheid Smart Cycler (Sunnyvale, CA) in the presence of SYBR green I nucleic acid stain (Molecular Probes) and 150 nM primers (Table

2

). Cycling was programmed at 95°C for 900 s, followed by 40 cycles at 94°C for 15 s, the optimal annealing temperature for the primer set as determined with MacVector 7.0 software (Table

2

) for 30 s, and then 72°C for 30 s. To confirm the absence of chromosomal DNA from our cDNA preparations, we used the reverse transcriptase negative control described above as a template for amplification with each primer set. All expression was normalized to that of the endogenous hk11 control gene, the expression of which we determined does not vary by more than 0.2 cycle threshold (CT) units under the experimental test conditions. Melt curves were analyzed to ensure specificity of primer annealing and lack of primer secondary structure, and relative standard curves were generated to assess primer pair efficiency and to calculate changes (n-fold). CT values represent the cycle at which the fluorescence levels of experimental reactions crossed the threshold of background fluorescence, which we defined as 30 fluorescence units.

Sodium dodecyl sulfate-polyacrylamide gel electrophoresis and Western blot analysis.

Sixty micrograms of total protein derived from S. mutans UA159, GMS584, and GMS585 crude cell extracts was resuspended in sample buffer containing sodium dodecyl sulfate, resolved on a 10% Tris-HCl precast gel (Bio-Rad) at 200 V for 45 min, and subsequently transferred to nitrocellulose membranes by use of a Hoeffer transfer apparatus. Immunoblotting was performed as described by Towbin et al. (

41

), using a rabbit polyclonal antiserum against the SloC protein in S. mutans (provided by Paula Fives-Taylor, University of Vermont). A peroxidase-conjugated goat anti-rabbit immunoglobulin G secondary antibody (Sigma) was subsequently applied to the membrane, and reacting proteins were visualized using enhanced chemiluminescence according to the recommendations of the supplier (Amersham).

Assay for S. mutans biofilm biomass.

The biomass of S. mutans UA159 and GMS584 biofilms was assessed by crystal violet release assays as previously described (

23

). Overnight cultures grown in THYE supplemented with erythromycin were diluted 1:15 in THYE, and 25 μl of mid-logarithmic-phase cells was used to inoculate 2 ml of SDM contained in a 24-well polystyrene microtiter dish. The microtiter dish was incubated at 37°C and 5% CO2 for 18 h prior to staining. Wells were inoculated in quadruplicate for each experimental condition, and control wells were inoculated with an equivalent amount of sterile distilled water.

Monitoring S. mutans biofilm architecture by scanning electron microscopy.

Biofilms were prepared in SDM as described previously (

43

), with the following modifications. S. mutans biofilms were grown on Thermonox coverslips (Nalge Nunc International, Rochester, N.Y.) in 24-well polystyrene microtiter plates containing 2 ml medium supplemented with 20 mM glucose or 10 mM sucrose. Wells were inoculated in duplicate with 25 μl of a UA159 or GMS584 overnight culture, which had been diluted in SDM to an OD600 of 0.4 to 0.6 to standardize the inoculum to within 0.02 absorbance units. Wells containing uninoculated SDM served as negative controls. Following incubation at 37°C and 5% CO2 for 48 h, the medium was carefully removed by aspiration and biofilms were washed with 10 mM PBS both before and after fixation with 3.7% formaldehyde in 10 mM PBS for 24 h. Biofilm architecture was examined with a JSM-T300 scanning electron microscope following sputter coating with a gold-palladium mixture. Morphometric analysis involved measuring the diameters of 23 randomly selected water channels on electron micrographs of S. mutans UA159 and GMS584 biofilms grown in the presence of sucrose.

Growth rate determination.

S. mutans UA159 and GMS584 overnight cultures diluted 20× in fresh THYE and grown to an OD600 of ∼0.4 to 0.5 were monitored for growth with a Bioscreen microbiology reader (Bioscreen C; Labsystems, Helsinki, Finland). Twenty microliters of mid-logarithmic-phase cells was inoculated in triplicate into 24-well microtiter plates containing 400 μl THYE. Wells containing uninoculated THYE were used as controls. By use of Biolink software (Labsystems), the Bioscreen reader was programmed to monitor OD600 at 37°C every 20 min for 24 h, with moderate shaking every 3 min. OD600 measurements were exported to an Excel file (Microsoft 2003), where they were averaged and plotted against time to generate growth curves.

Assay for genetic competence.

S. mutans UA159 and GMS584 overnight cultures grown in THYE with appropriate antibiotic selection were harvested by centrifugation, washed in prewarmed THYE, and diluted in prewarmed THYE to an OD600 of 0.1. One microgram of plasmid pDL277 was added to the cell suspensions for transformation in the presence of 150 μg competence-stimulating peptide as previously described (

22

). Control groups were treated identically except that sterile distilled water was added to the transformation mixture instead of plasmid DNA. Cell suspensions were incubated at 37°C and 5% CO2 with gentle agitation for 3 h and then plated onto THYE agar plates supplemented with spectinomycin. The plates were incubated at 37°C and 5% CO2 for 36 to 48 h, at which time colonies were counted to determine transformation efficiency.

Assay for S. mutans metal ion incorporation during growth.

Overnight cultures of UA159 and GMS584 were grown to stationary phase, in the presence of 7.4 × 104 Bq 55FeCl3 (3 μM) or 54MnCl2 (0.03 μM), and then washed twice in fresh THB supplemented with 2 μM MnSO4. Radioactivity associated with bacterial cell pellets and culture supernatants, combined with successive washes, was measured with a scintillation counter calibrated for 55Fe or 54Mn. The bacterial incorporation of 55Fe and 54Mn was determined by dividing the radioactivity associated with the cell pellet (in counts per minute) by the total radioactivity associated with the bacterial cell pellet plus the culture supernatant/washes (in counts per minute).

Assay for oxidative stress tolerance.

S. mutans overnight cultures grown in THYE with appropriate antibiotic selection were diluted 1:15 in more of the same fresh medium. Mid-logarithmic-phase cells (OD600 = 0.4 to 0.6) were harvested by centrifugation and washed in 0.1 M glycine (pH 7.0), from which 100-μl aliquots were further diluted 1:10 in 0.1 M glycine and stored on ice. The cell suspensions were exposed to oxidative stress upon addition of 30% H2O2 (final concentration, 58.8 mM) and mixed by inversion. At 20, 40, 60, and 80 min, 100 μl of cells was removed and diluted 1:10 in glycine buffer containing 5 mg/ml catalase (Sigma-Aldrich). Cells from UA159 and GMS584 suspensions were subsequently plated on THYE agar and THYE agar supplemented with erythromycin, respectively, and grown at 37°C and 5% CO2 for 36 to 48 h. Colonies were counted and percent survivorship quantified as the number of CFU that survived exposure to H2O2 per number of CFU that were not exposed to the stressor.

RESULTS

Confirmation of the knockout mutation in S. mutans GMS584.

PCR analysis with primers dlg.LR.P1 and dlg.LR.P4 (Table

2

) was used to confirm disruption of the sloR locus on the S. mutans GMS584 chromosome (Fig.

1

). Nucleotide sequence analysis of GMS584 chromosomal DNA with dlg.LR.P1, dlg.LR.P2, dlg.LR.P3, and dlg.LR.P4 primers (Table

2

) also confirmed incorporation of the 860-bp erythromycin cassette into the sloR coding sequence by allelic exchange (Fig.

1

). Moreover, the expression of sloR in GMS584 was 230-fold less than in the wild type, as determined by real-time qRT-PCR experiments (Table

3

), consistent with sloR inactivation in GMS584. In addition, the CT values we noted for the mutant and the no-template control were comparable (29.26 and 29.5, respectively), indicating that little if any sloR-specific mRNA is present in GMS584.

TABLE 3.

Impact of SloR inactivation on S. mutans gene expression

Gene(s)Gene product(s)Type of change in expression in GMS584Fold change

a

sloRMetal ion-dependent transcriptional regulatorDecrease230sloABCMetal ion transporter, surface adhesion proteinIncrease29comDHistidine kinase sensor proteinDecrease1.6comECognate response regulatorDecrease1.7ropATrigger factor, surface protein biogenesis, chaperone proteinDecrease6.0sodSuperoxide dismutase (oxidative stress defense)Decrease2.2spaPCell surface antigen, saliva-interacting proteinDecrease6.0gbpBGlucan binding proteinDecrease1.5gtfBGlucosyltransferaseDecrease2.6sko6Hypothetical putative gramicidin synthetase enzymeDecrease3.4sko9Hypothetical putative integral membrane proteinDecrease2.9a

Expression relative to that in UA159 and normalized to an S. mutans hk11 endogenous control.

Complementation of GMS584.

We confirmed the sloR-specific mutation in GMS584 by complementation in trans in pER4-containing transformants. The expression of sloR was restored to near-wild-type levels in these transformants, as revealed by real-time qRT-PCR. Specifically, sloR-specific expression in the GMS585 complemented strain was amplified in real time at nearly the same cycle number as for the wild type (CT = 22.74 and 21.28, respectively), compared to the GMS584 mutant strain (CT = 29.26), in which sloR expression is diminished. In addition, sloC-specific expression was restored to near-wild-type levels in the complemented GMS585 strain, (CT = 23.04 and 22.28 in GMS585 and UA159, respectively), with sloC amplification occurring considerably earlier (CT = 16.97) in GMS584, where sloC expression is heightened. Taken collectively, these findings support complementation of the GMS584 sloR-specific mutation in trans.

Identification of candidate genes subject to SloR control in silico.

In silico analysis of the S. mutans genome revealed palindromic SloR consensus sequences in the promoter regions of multiple genes, including sloABC, ropA, and spaP. Genes whose levels of expression were differentially expressed in real-time qRT-PCR experiments and which shared sequence identity with putative metal ion transporters and mediators of S. mutans virulence were selected for further analysis by gel mobility shift assays.

Gel mobility shift assays.

To confirm that disruption of the sloR coding sequence in GMS584 rendered the resulting SloR protein dysfunctional, we conducted gel mobility shift experiments with S. mutans GMS584 and UA159 whole-cell lysates. The results of these studies revealed a shift for the sloABC promoter region when reacted with the wild-type repertoire of proteins but no shift when proteins from the mutant were present in the reaction mixture (data not shown). In separate assays, the presence of increasing concentrations of the SloR fusion protein increased the magnitude of the band shift, consistent with SloR oligomerization (Fig.

2

). This supports the work of others, who described the oligomerization of the DtxR metalloregulator in Corynebacterium diphtheriae (

31

).

FIG. 2.

FIG. 2.
FIG. 2.

The results of gel mobility shift assays are consistent with oligomerization of SloR. The 310-bp promoter region of S. mutans sloABC was PCR amplified and end labeled with [γ-32P]ATP. A gel mobility shift assay was performed with an MBP or a SloR fusion protein provided in increasing concentrations (2.5, 5, 10, and 20 μg). As shown, increasing concentrations of SloR increase the magnitude of the band shift. The addition of EDTA abrogated the band shift and is consistent with metal ion-dependent SloR binding.

The results of gel shift assays performed with a SloR fusion protein that we purified from S. mutans UA159 revealed SloR binding to the promoter regions of the sloABC, sloR, comDE, ropA, sod (superoxide dismutase), and spaP genes, the products of which likely contribute to S. mutans virulence (Fig.

3

). Binding of the SloR metalloregulator to the sloR-specific promoter sequence was also noted, although no palindromic consensus sequence was identified in this region. Addition of EDTA to the gel shift reaction mixtures abrogated the band shift, and substitution of the SloR:MBP fusion protein with purified MBP yielded no shift. Binding assays performed with up to 10-fold excess cold noncompeting recA DNA confirmed the specificity of SloR binding to the test promoter regions (Fig.

3

).

FIG. 3.

FIG. 3.
FIG. 3.

Gel shift assays confirm SloR targets in the S. mutans genome. The promoter regions of S. mutans genes targeted for SloR binding were PCR amplified and end labeled with [γ-32P]ATP. Gel mobility shift assays were performed with a SloR fusion protein or an MBP. A 212-bp amplicon containing the recA promoter region that is devoid of a SloR consensus sequence was used as a negative control. In competition assays (shown here for sloABC), addition of up to 10-fold excess cold recA DNA had no effect on the band shift. Taken collectively, these results indicate that SloR binds specifically to the sloABC, sloR, comDE, ropA, sod, and spaP promoters and that, upon addition of EDTA to the reaction mixture, binding is metal ion dependent.

Real-time PCR.

The results of real-time qRT-PCR experiments revealed differential expression levels in GMS584 and UA159 for several genes identified in silico and for other genes identified as possible targets of SloR control by gel shift assays. For instance, the expression levels of ropA, spaP, comDE, sod, sko6, and sko9 were down-regulated in GMS584 relative to wild-type levels (Table

3

). Importantly, reverse transcriptase negative-control reactions confirmed the absence of contaminating DNA from the RNA templates. Moreover, analysis of melting curves revealed specific primer annealing and lack of primer secondary structure, and relative standard curves showed acceptable primer pair efficiency.

Western blotting.

Immunoblotting of S. mutans UA159, GMS584, and GMS585 whole-cell lysates reacted with a polyclonal antiserum directed against the S. mutans SloC protein revealed derepression of a 34-kDa band in GMS584 relative to wild-type levels (Fig.

4

). This is consistent with compromised binding of an altered SloR protein to the SloR consensus sequence located upstream of the sloABC operon on the S. mutans chromosome. Furthermore, these results corroborate successful complementation of the sloR mutation in GMS585 transformants.

FIG. 4.

FIG. 4.
FIG. 4.

Immunoblots with an anti-SloC antibody support disruption of SloR in GMS584. Western blotting of S. mutans UA159, GMS584, and GMS585 protein extracts reveals the presence of a 34-kDa SloC protein in all strains, the expression of which is up-regulated considerably in GMS584, consistent with disruption of the sloR gene in this strain. Conversely, down-regulation of SloC in the pER4-transformed GMS585 strain supports reversion of this mutant to the wild type, owing to complementation of the sloR defect in this strain in trans. Partial repression of sloC in the wild-type UA159 strain is likely due to the presence of exogenous Mn (1.75 μM), which we confirmed in SDM by inductively coupled argon plasma analysis.

Characterization of S. mutans biofilms.

To define a putative role for SloR in S. mutans biofilm formation, crystal violet release assays and growth determination experiments were performed. The results of these studies revealed similar doubling times and biofilm biomasses (data not shown) for S. mutans UA159 and GMS584. Despite these similarities, these strains demonstrated notably different biofilm architectures on scanning electron micrographs (Fig.

5

). For S. mutans biofilms grown in the presence of dextrose, GMS584 behaved much like an aggregation mutant, with cells demonstrating considerably more clumping than wild-type cells. However, morphometric analysis of GMS584 biofilms grown in the presence of sucrose revealed significantly larger water channels in the mutant (on average, 57.7 μm in GMS584 versus 36.6 μm in UA159, independent-samples t test, P < 0.01).

FIG. 5.

FIG. 5.
FIG. 5.

Scanning electron micrographs of S. mutans UA159 and GMS584 biofilms formed on polystyrene coverslips. Shown are representative regions of UA159 and GMS584 biofilms. GMS584 biofilms grown in the presence of dextrose demonstrate pronounced cellular aggregation (white arrows) relative to wild-type biofilms. Morphometric analysis of GMS584 biofilms grown in the presence of sucrose reveals significantly larger water channels (white dotted lines) than those present in UA159 biofilms (mean diameter, 57.7 μm for GMS584 versus 36.6 μm for UA159, independent-samples t test, P < 0.01).

Genetic competence in GMS584.

To determine if altered biofilm formation in GMS584 has any impact on genetic competence, we determined the transformation efficiencies of the mutant and wild-type strains upon transformation with 1 μg of plasmid pDL277 in the presence of CSP. The results of these experiments (n = 9) confirm that genetic competence is compromised nearly threefold in GMS584 relative to the wild type (data not shown). Consistent with these findings are the results of real-time qRT-PCR experiments, which revealed a 1.7-fold decrease in expression for the comE response regulator and its cognate comD histidine kinase in GMS584 compared to levels for the wild type.

Metal ion incorporation by GMS584.

To determine whether metal ion transport is compromised in GMS584, we monitored the accumulation of 55FeCl3 and 54MnCl2 in S. mutans GMS584 and UA159 cultures grown in THYE (Fig.

6

). We noted significantly increased 55Fe incorporation in the mutant (5.56% in GMS584 and 1.92% in UA159, independent-samples t test, P = 0.050). 54Mn incorporation in the mutant was also increased, although this difference was only trending toward significance (35.53% in GMS584 and 20.5% in UA159, independent-samples t test, P = 0.127).

FIG. 6.

FIG. 6.
FIG. 6.

55Fe and 54Mn incorporation is greater in GMS584 than in the wild-type progenitor. The results of 55Fe and 54Mn incorporation assays are represented as counts per minute associated with the bacterial cell pellet divided by the total counts per minute associated with the bacterial cell pellet plus the culture supernatant/washes multiplied by 100. (a) 55Fe incorporation was significantly greater in GMS584 than in the UA159 wild-type progenitor (independent-samples t test, P = 0.05). (b) 54Mn incorporation was greater in GMS584 than in the wild type, although this difference only approaches statistical significance (independent-samples t test, P = 0.127).

Resistance to oxidative stress in GMS584.

To determine the sensitivity of GMS584 to oxidative stress and to discover whether SloR might be involved in the S. mutans oxidative stress response, we compared the levels of resistance of the GMS584 and UA159 strains to challenge with sublethal concentrations of H2O2 [58.8 mM]. Surprisingly, survivorship of the mutant was nearly threefold greater than that of the wild type after a 20-min exposure to the hydrogen peroxide stressor (data not shown). This finding is consistent with the results of preliminary experiments performed in our laboratory which used paraquat as the stressor, for which the mutant also demonstrated a heightened tolerance to oxidative stress (data not shown).

DISCUSSION

In the present study, we characterized an S. mutans sloR-deficient mutant (GMS584) that was compromised for genetic competence relative to the UA159 wild type but that demonstrated increased incorporation of iron and manganese and heightened resistance to oxidative stress. GMS584 also formed altered biofilms, with pronounced cell aggregation for cultures grown in the presence of dextrose and enlarged water channels for cultures supplemented with sucrose. These phenotypic assays were performed in rich THB or THYE media, however, which we propose might have an inhibitory effect on bacterial gene expression and cell signaling. Specifically, the results of real-time qRT-PCR experiments revealed differences in S. mutans gene expression levels that were less pronounced when cells were grown in THYE than when cells were grown in SDM (unpublished observations). This is consistent with work conducted by Merritt et al., who reported inhibition of the S. mutans luxS gene expression for cells grown in rich media containing glucose and sucrose (

29

). To address this putative medium effect, we performed all of our real-time qRT-PCR experiments, as well as scanning electron microscopy biofilm visualization, in an SDM that contains iron and manganese concentrations commensurate with those we noted in human saliva (0.1 to 10 μM [unpublished observations]).

The incorporation of 55Fe was increased in S. mutans GMS584 (Fig.

6a

), indicating that SloR functions as a repressor of S. mutans iron transporters under the wild-type condition. This is consistent with real-time qRT-PCR experiments that support derepression of the sloC metal ion transporter in GMS584. We believe 54Mn transport is also subject to repression by SloR, since incorporation of this metal ion in GMS584 was consistently greater than that of the wild type across biological replicates. However, considerable variation in 54Mn transport, recorded in counts per minute, across replicate experiments gave rise to a data set with high standard error (Fig.

6b

), which is the reason these data were only trending toward significance.

The results of gel mobility shift assays confirmed the metal ion-dependent binding of SloR to DNA containing a conserved 32-bp SloR palindrome (CTAATATAAAAATTAACTTGACTTAATTTTTATATTAG) in the sloABC promoter region, as well as to a 184-bp intervening region that is devoid of this sequence and located immediately downstream of sloC and upstream of the sloR gene on the S. mutans chromosome. This finding supports autoregulation of SloR. The absence of a conventional SloR consensus sequence from the sloR promoter region, however, suggests that SloR may also bind to unique sequences to regulate downstream genes. Alternatively, the consensus sequence for SloR binding may be degenerate in this intergenic region, further confounding the identification of an AT-rich consensus sequence in an S. mutans genome with less than 40% GC content. Abrogation of the band shifts in the presence of EDTA supports a SloR-DNA interaction that is metal ion dependent. Additionally, substitution of the SloR:MBP fusion protein with purified MBP in the gel shift reaction mixture gave rise to no band shift, indicating that the noted protein-DNA interaction is mediated by the SloR (and not the MBP) portion of the fusion protein. We did not use a pure SloR protein in our gel shift experiments because repeated attempts to cleave the MBP tag from the fusion construct were unsuccessful, even when performed under a variety of test conditions. In summary, our findings support dual control of the sloR gene from the sloABC promoter as well as from an independent promoter and suggest an essential role for SloR in S. mutans.

The results of gel mobility shift assays also revealed binding of the SloR-MBP fusion protein to the promoter regions of the S. mutans sloABC, comDE, ropA, sod, and spaP genes (Fig.

3

). SloC is an LraI lipoprotein adhesin that comprises part of an ABC-type operon on the S. mutans chromosome (

14

) and functions as a transporter of iron and manganese (

10

,

19

). Previous work conducted in our laboratory revealed sloC derepression in a UA130 sloR-deficient mutant, called GMS800 (

38

). The results of real-time qRT-PCR performed in the present study confirmed derepression of sloC expression in the UA159-derived GMS584 mutant (Table

3

), thereby supporting SloR as a repressor of S. mutans sloC expression. Indeed, our results are consistent with reports in the literature that describe a repressor role for SloR homologues in metalloregulation (

16

,

40

). In contrast to the repressor effect of SloR on sloC, the results of real-time qRT-PCR studies implicate SloR metalloregulation in maintaining expression of comDE, ropA, sod, spaP, gbpB, gtfB, sko6, and sko9 (Table

3

). This is consistent with the reported role for the IdeR metalloregulator in Mycobacterium tuberculosis, which likewise promotes the expression of some genes, while repressing the expression of others (

34

).

The comC and comDE genes encode a competence-stimulating peptide and a histidine kinase sensor protein and its cognate response regulator, respectively, and act in concert to regulate competence in S. mutans (

23

). Previous studies report that S. mutans strains deficient in any component of the comCDE pathway are significantly compromised for genetic competence (

22

). Moreover, S. mutans strains with defects in comD or comE were unable to produce bacteriocin, a class of molecules involved in DNA release from neighboring bacteria, and formed thin biofilms with reduced biomass compared to those of the wild type. Since the phenotype of GMS584 is consistent with that of a comCDE mutant, we decided to investigate the regulation of the com genes in this mutant. The results of qRT-PCR experiments revealed repression of comDE expression in GMS584, consistent with the noted decrease in genetic competence in the mutant and with maintenance of comDE expression by SloR in the wild type. However, the biomasses of GMS584 and UA159 biofilms were similar, indicating that decreased comDE expression in GMS584 is not sufficient to impact accumulation of the biofilm on an abiotic surface.

The ropA gene product is a trigger factor and critical stress response element in S. mutans (

45

). Reports in the literature describe an S. mutans ropA-deficient mutant, TW90, that demonstrates altered biofilm architecture on scanning electron micrographs and increased sensitivity to acid and oxidative stress in vitro (

45

). The altered biofilm architecture and down-regulation of ropA we observed for GMS584 in this study reinforce the reported role for ropA in mediating appropriate formation of the S. mutans biofilm. Taken collectively, these findings implicate the ropA gene product in S. mutans disease, although to our knowledge in vivo studies have not yet been performed to define a specific role for ropA in cariogenesis.

The superoxide dismutase gene (sod) encodes an enzyme that plays a major role in bacterial defense against oxidative stress. The sod gene product promotes the conversion of damaging superoxides into harmless by-products. S. mutans harbors a single manganese-dependent superoxide dismutase, and mutants deficient in this activity grow more slowly under aerobic conditions than the wild type (

32

). In the present study, we noted sod expression that was down-regulated twofold in GMS584 compared to expression in UA159. However, the results of hydrogen peroxide challenge assays revealed that the mutant has increased tolerance to oxidative stress. It is possible that the pronounced aggregation we noted in GMS584 biofilms, while having an as-yet-undetermined effect in vivo, may serve to protect S. mutans from the deleterious effects of radical oxygen species. Wen and Burne (

44

) describe a similar phenotype for a luxS knockout mutant that demonstrates heightened resistance to oxidative stress. It is also possible that other S. mutans oxidative stress genes are up-regulated in the mutant and thereby compensate for sod repression. There is precedent in the literature for this, in light of redundant oxidative stress response genes, the expression levels of which can vary widely (

11

). In summary, these findings underscore the fact that oxidative stress defense is a very high priority for the bacteria.

The spaP gene encodes an antigen I/II polypeptide called P1 that is involved in sucrose-independent adherence (

7

). Mutants deficient in spaP are nonadherent in vitro and give rise to significantly fewer carious lesions on the molar surfaces of germ-free rats (

7

). In fact, the spaP gene product contributes to S. mutans virulence by facilitating the formation of the plaque biofilm, which creates a microenvironment suitable for the progression of carious lesions.

Among the genes we identified as targets of SloR control by real-time qRT-PCR are gtfB and gbpB, which encode a glucosyltransferase and a glucan binding protein, respectively. Glucosyltransferase B synthesizes insoluble glucans from sucrose, which, in turn, associate with glucan binding proteins such as gbpB in sucrose-dependent adherence. It has been shown that gtfB expression is up-regulated in S. mutans cells grown as biofilms but not when grown planktonically. Moreover, the production of GbpB protein has been positively correlated with the ability of S. mutans to grow in biofilms. Taken collectively, these genes are among the most significant contributors to S. mutans colonization and subsequent disease (

28

,

48

).

A hypothetical gene that we call sko6 is as yet uncharacterized in S. mutans but shares amino acid identity with gramicidin synthetase enzymes from Bacillus subtilis and Bacillus brevis. Another hypothetical gene, sko9, encodes a putative integral membrane protein containing domains that have been implicated in membrane transport. A putative Sko9 homologue in Pyrococcus abyssi has been implicated in glucose-dependent multidrug resistance through efflux transport. The S. mutans sko6 and sko9 genes are located within a 13-gene cluster flanked by putative transposons, the organization of which is consistent with a polycistronic operon. At least five additional genes within this cluster also encode proteins putatively associated with antibiotic regulation. Further characterization of the regulation and function of this group of putative antibiotic regulatory genes is ongoing in our laboratory.

Taken collectively, the SloR metalloregulator functions in S. mutans as a positive regulator of virulence gene expression, including comDE, ropA, sod, spaP, sko6, sko9, gbpB, and gtfB expression, and a negative regulator of metal ion transporters, such as sloC. Such control is consistent with the principles of evolution and bacterial virulence, that is, intermediate virulence is often the preferred strategy for successful pathogens, since it serves to sustain both host and microbe over time (

13

). Ultimately, such an evolutionary détente can promote bacterial persistence within a host, as well as dissemination of a pathogen from one host to another. S. mutans is a prime example of this infection model, given that it persists in the transient conditions of the human oral cavity over the lifetime of the host and is transmitted from the dentition of one host to another almost ubiquitously. To strike a delicate balance with its host, we believe S. mutans depends on metalloregulation to fine-tune the expression of its virulence attributes. Specifically, when metal ions are limiting in the oral cavity (such as between mealtimes), the SloR metalloregulator cannot readily bind to DNA, and hence the expression of S. mutans virulence genes that are otherwise “off” is derepressed. When metal ions become plentiful (such as during or shortly after mealtimes), metal ion transport genes that are normally “on” are repressed so as to protect the microbe from metal ion toxicity. The result is to promote S. mutans-induced cariogenesis as the microbe actively scavenges essential micronutrients and to down-regulate cariogenesis as transport proteins readily bind metal ions for incorporation. Ultimately, intermediate pathogenicity is achieved; the payoff is a dentition that can sustain S. mutans for a lifetime and a pathogen that can successfully promote its transmission to new hosts.

In summary, the importance of metal ions in modulating a putative S. mutans regulon that contributes to virulence is highlighted by the increased incorporation of metal ions noted for the SloR-deficient GMS584 mutant in this study, together with the multiple S. mutans virulence attributes we report as subject to SloR control. We expect microarray studies under way in our laboratory will support the putative relationships we observed in this study between SloR, metal ion availability, and S. mutans virulence and will identify other targets of SloR control. We acknowledge that the SloR effects reported herein may be the result of direct or indirect impact on gene expression. Continued investigations will address probable cross talk between and among members of the SloR regulon.

REFERENCES

1.Adkins, B. L., and F. L. Losee. 1970. A study of covariation of dental caries prevalence and multiple trace element content of water supplies. N. Y. State Dent. J. 36:618-622. [

PubMed

] [

Google Scholar

]

2.Aranha, H., R. C. Strachan, J. E. L. Arceneaux, and B. R. Byers. 1982. Effect of trace metals on growth of Streptococcus mutans in a Teflon chemostat. Infect. Immun. 35:456-460. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

3.Bates, C. S., C. Toukoi, M. N. Neely, and Z. Eichenbaum. 2005. Characterization of MtsR, a new metal regulator in group A streptococcus, involved in iron acquisition and virulence. Infect. Immun. 73:5743-5753. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

4.Bauer, P. D., C. Trapp, D. Drake, K. G. Taylor, and R. J. Doyle. 1993. Acquisition of manganous ions by mutans group streptococci. J. Bacteriol. 175:819-825. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

5.Beighton, D. 1982. The influence of manganese on carbohydrate metabolism and caries induction by Streptococcus mutans strain Ingbritt. Caries Res. 16:189-192. [

DOI

] [

PubMed

] [

Google Scholar

]

6.Bhagwat, S. P., J. Nary, and R. A. Burne. 2001. Effects of mutating putative two-component systems on biofilm formation by Streptococcus mutans UA159. FEMS Microbiol. Lett. 205:225-230. [

DOI

] [

PubMed

] [

Google Scholar

]

7.Crowley, P. J., L. J. Brady, S. M. Michalek, and A. S. Bleweis. 1999. Virulence of a spaP mutant of Streptococcus mutans in a gnotobiotic rat model. Infect. Immun. 67:1201-1206. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

8.Dale, S. E., M. T. Sebulsky, and D. E. Heinrichs. 2004. Involvement of SirABC in iron-siderophore import in Staphylococcus aureus. J. Bacteriol. 186:8356-8362. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

9.Dall, L. H., and B. L. Herndon. 1990. Association of cell-adherent glycocalyx and endocarditis production by viridans group streptococci. J. Clin. Microbiol. 28:1698-1700. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

10.Dintilhac, A., and J. P. Claverys. 1997. The adc locus, which affects competence for genetic transformation in Streptococcus pneumoniae, encodes an ABC transporter with a putative lipoprotein homologous to a family of streptococcal adhesions. Res. Microbiol. 148:119-131. [

DOI

] [

PubMed

] [

Google Scholar

]

11.Eriksson, S., S. Lucchini, A. Thompson, M. Rhen, and J. C. Hinton. 2003. Unravelling the biology of macrophage infection by gene expression profiling of intracellular Salmonella enterica. Mol. Microbiol. 47:103-118. [

DOI

] [

PubMed

] [

Google Scholar

]

12.Evans, S. L., J. E. L. Arceneaux, B. R. Byers, M. E. Martin, and H. Aranha. 1986. Ferrous iron transport in Streptococcus mutans. J. Bacteriol. 168:1096-1099. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

13.Ewald, P. 1994. Evolution of infectious disease. Oxford University Press, New York, N.Y.

14.Fenno, J. C., A. Shaikh, G. Spatafora, and P. Fives-Taylor. 1995. The fimA locus of Streptococcus parasanguis encodes an ATP-binding membrane transport system. Mol. Microbiol. 15:849-863. [

DOI

] [

PubMed

] [

Google Scholar

]

15.Hanahan, D. 1983. Studies on transformation of Escherichia coli with plasmids. J. Mol. Biol. 166:557-580. [

DOI

] [

PubMed

] [

Google Scholar

]

16.Hill, P. J., A. Cockayne, P. Landers, J. A. Morrisey, C. A. Sims, and P. Williams. 1998. SirR, a novel iron-dependent repressor in Staphylococcus epidermidis. Infect. Immun. 66:4123-4129. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

17.Jakubovics, N. S., A. W. Smith, and H. F. Jenkinson. 2000. Expression of the virulence-related Sca (Mn2+) permease in Streptococcus gordonii is regulated by a diphtheria toxin metallorepressor-like protein ScaR. Mol. Microbiol. 38:140-153. [

DOI

] [

PubMed

] [

Google Scholar

]

18.Kitten, T., C. L. Munro, S. M. Michalek, and F. L. Macrina. 2000. Genetic characterization of a Streptococcus mutans LraI family operon and role in virulence. Infect. Immun. 68:4441-4451. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

19.Kolenbrander, P. E., R. N. Anderson, R. A. Baker, and H. F. Jenkinson. 1998. The adhesion-associated sca operon in Streptococcus gordonii encodes an inducible high-affinity ABC transporter for Mn2+ uptake. J. Bacteriol. 189:290-295. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

20.Lau, P. C. Y., C. K. Sung, J. H. Lee, D. A. Morrison, and D. G. Cvitkovitch. 2002. PCR ligation mutagenesis in transformable streptococci: application and efficiency. J. Microbiol. Methods 49:193-205. [

DOI

] [

PubMed

] [

Google Scholar

]

21.Lee, J. H., T. Wang, K. Ault, J. Liu, M. P. Schmitt, and R. K. Holmes. 1997. Identification and characterization of three new promoter/operators that are regulated by the diphtheria toxin repressor (DtxR) and iron. Infect. Immun. 65:4273-4280. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

22.Li, Y. H., P. C. Y. Lau, J. H. Lee, R. P. Ellen, and D. G. Cvitkovitch. 2001. Natural genetic transformation of Streptococcus mutans growing in biofilms. J. Bacteriol. 183:897-908. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

23.Li, Y. H., P. C. Y. Lau, N. Tang, G. Svensäter, R. P. Ellen, and D. G. Cvitkovitch. 2002. Novel two-component regulatory system involved in biofilm formation and acid resistance in Streptococcus mutans. J. Bacteriol. 184:6333-6342. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

24.Loo, C. Y., K. Mitrakul, I. B. Voss, C. V. Hughes, and N. Ganeshkumar. 2003. Involvement of the adc operon and manganese homeostasis in Streptococcus gordonii biofilm formation. J. Bacteriol. 185:2887-2900. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

25.Lü-Lü, J. S. Singh, M. Y. Galperin, D. Drake, K. G. Taylor, and R. J. Doyle. 1992. Chelating agents inhibit activity and prevent expression of streptococcal glucan-binding lectins. Infect. Immun. 60:3807-3813. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

26.Madigan, M. T., J. M. Martinko, and J. Parker. 2000. Brock biology of microorganisms. Prentice Hall, Upper Saddle River, N.J.

27.Manabe, Y. C., B. J. Saviola, L. Sun, J. R. Murphy, and W. R. Bishai. 1999. Attenuation of virulence in Mycobacterium tuberculosis expressing a constitutively active iron repressor. Proc. Natl. Acad. Sci. USA 96:12844-12848. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

28.Mattos-Graner, R. O., S. Jin, W. F. King, T. Chen, D. J. Smith, and M. J. Duncan. 2001. Cloning of the Streptococcus mutans gene encoding glucan binding protein B and analysis of genetic diversity and protein production in clinical isolates. Infect. Immun. 69:6931-6941. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

29.Merritt, J., F. Qi, S. D. Goodman, M. H. Anderson, and W. Shi. 2003. Mutation of luxS affects biofilm formation in Streptococcus mutans. Infect. Immun. 71:1972-1979. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

30.Miguel, J. C., W. H. Bowen, and S. K. Pearson. 1997. Effects of iron salts in sucrose on dental caries and plaque in rats. Arch. Oral Biol. 42:377-383. [

DOI

] [

PubMed

] [

Google Scholar

]

31.Murphy, J. 2006. Personal communication.

32.Nakayama, K. 1992. Nucleotide sequence of Streptococcus mutans superoxide dismutase gene and isolation of insertion mutants. J. Bacteriol. 174:4928-4934. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

33.Pope, C. D., W. A. O'Connel, and N. P. Cianciotto. 1996. Legionella pneumophila mutants that are defective for iron acquisition and assimilation and intracellular infection. Infect. Immun. 64:629-636. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

34.Rodriguez, G. M., M. I. Voskuil, B. Gold, G. K. Schoolnik, and I. Smith. 2002. ideR, an essential gene in Mycobacterium tuberculosis: role of ideR in iron-dependent gene expression, iron metabolism, and oxidative stress response. Infect. Immun. 70:3371-3381. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

35.Rosalen, P. L., S. K. Pearson, and W. H. Bowen. 1996. Effects of copper, iron and fluoride cocrystallized with sugar on caries development and acid formation in desalivated rats. Arch. Oral Biol. 41:1003-1010. [

DOI

] [

PubMed

] [

Google Scholar

]

36.Sambrook, J., E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Harbor Laboratory Press, Cold Spring Harbor, N.Y.

37.Schmitt, M. P., and R. K. Holmes. 1994. Cloning, sequence, and footprint analysis of two promoter/operators from Corynebacterium diphtheriae that are regulated by the diphtheria toxin repressor (DtxR) and iron. J. Bacteriol. 176:1141-1149. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

38.Spatafora, G., M. Moore, S. Landgren, E. Stonehouse, and S. Michalek. 2001. Expression of Streptococcus mutans fimA is iron-responsive and regulated by a DtxR homologue. Microbiology 147:1599-1610. [

DOI

] [

PubMed

] [

Google Scholar

]

39.Stamer, J. R., M. N. Albury, and C. S. Pederson. 1964. Substitution of manganese for tomato juice in the cultivation of lactic acid bacteria. Appl. Microbiol. 12:165-168. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

40.Tao, X., and J. R. Murphy. 1992. Binding of the metalloregulatory protein DtxR to the diphtheria tox operator requires a divalent heavy metal ion and protects the palindromic sequence from DNase I digestion. J. Biol. Chem. 267:21761-21764. [

PubMed

] [

Google Scholar

]

41.Towbin, H., T. Staehlin, and J. Gordon. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. USA 76:4350-4354. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

42.Weinberg, E. D. 1978. Iron and infection. Microbiol. Rev. 42:45-66. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

43.Wen, Z. T., and R. A. Burne. 2002. Functional genomics approach to identifying genes required for biofilm development by Streptococcus mutans. Appl. Environ. Microbiol. 68:1196-1203. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

44.Wen, Z. T., and R. A. Burne. 2004. LuxS-mediated signaling in Streptococcus mutans is involved in regulation of acid and oxidative stress tolerance and biofilm formation. J. Bacteriol. 186:2682-2691. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

45.Wen, Z. T., P. Suntharaligham, D. G. Cvitkovitch, and R. A. Burne. 2005. Trigger factor in Streptococcus mutans is involved in stress tolerance, competence development, and biofilm formation. Infect. Immun. 73:219-225. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

46.Wooldridge, K. G., and P. H. Williams. 1993. Iron uptake mechanisms of pathogenic bacteria. FEMS Microbiol. Rev. 12:325-348. [

DOI

] [

PubMed

] [

Google Scholar

]

47.Yellboina, S., J. Seshadri, M. S. Kumar, and A. Ranjan. 2004. PredictRegulon: a web server for the prediction of regulatory protein binding sites and operons in prokaryote genomes. Nucleic Acids Res. 32:W318-W320. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

48.Yoshida, A., and H. K. Kuramitsu. 2002. Streptococcus mutans biofilm formation: utilization of a gtfB promoter-green fluorescent protein (PgtfB::gfp) construct to monitor development. Microbiology 148:3385-3394. [

DOI

] [

PubMed

] [

Google Scholar

]

49.Zhao, Q., and K. Poole. 2002. Differential effects of mutations in tonB1 on intrinsic multidrug resistance and iron acquisition in Pseudomonas aeruginosa. J. Bacteriol. 184:2045-2049. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]

50.Zuker, M. 2003. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 31:3406-3415. [

DOI

] [

PMC free article

] [

PubMed

] [

Google Scholar

]